The cyclization of the target pheromone went very smoothly, but Xu Yun did not relax at all.
 This biomedical laboratory will be used for fourteen days, although on the surface, the research team can be considered successful as long as it solves the synthesis of the fourth generation imidacloprid within this time.
 But as mentioned before, Xu Yun's ultimate goal is far from being as simple as a fourth generation.
 Because this experiment required a large amount of equipment, the entire project was named Tian Liangwei's auxiliary project from the beginning.
 Once the time limit expires, it will be difficult for even Tian Liangwei to provide Xu Yun with such good experimental conditions.
 Therefore, this can be said to be Xu Yun's best opportunity at the moment. If he misses it, the research and development of the fifth generation imidacloprid will be delayed at least, and the opening of knowledge points and time and space dungeons may be affected at worst.
 Therefore, after completing the cyclization of the target pheromone, Xu Yun and others did not slack off at all and continued the stirring reaction for 12 hours.
 In the early morning of the next day, the quenching reaction was carried out with saturated NH4Cl aqueous solution while cooling in an ice bath.
 At this point, all that remains is to synthesize the pheromone-binding protein with imidacloprid, which is also the main direction of several biology graduate students.
 In layman's terms, this link is an infinite trial of luck. The cyclized pheromone-binding protein is like an iron ring. For a better understanding, let's assume that it is divided into twelve grids according to the clock scale.
 What Xu Yun and others have to do is to take a small steel ball and throw it down from top to bottom. Since they have done ring processing on the 9 to 12 o'clock direction, the landing point of the steel ball must be between 9 and 12 o'clock.
 But this scale is far from fine enough. Only when the steel ball falls steadily on the number 46 can the synthesis of Xu Yun and others be considered successful - please note that this is only a relatively easy-to-understand statement from a macro perspective. In fact, that The scale numbers on the disc are countless times larger than 12, for example...
 "22440484 pairs!"
 In the laboratory, Zhou Peiyao looked at the numbers sequenced by the Illumina HiSeq high-throughput second-generation sequencing platform and said to Xu Yun calmly:
 "Senior, we studied the binding ability of two OBPs to the target pheromone through a small molecule fluorescence competitive binding experiment. The total amount of base data obtained was about 6.6 G. The read number after filtering out the original data was 22440484.
 The genome alignment consistency between the target pheromone and the American cockroach sample is about 84.62%, while that of the German cockroach is 83.68%. The theoretical value of the junction reads is 648! "
 22440484 to 648, a probability of one in 35,000. This is by no means a simple matter.
 Hearing this number, Xu Yun nodded slightly and turned to Qiu Sheng:
 "Lao Qiu, it's up to us."
 Qiu Sheng patted him on the shoulder and said with a smile:
 "There's nothing to say, Gan. At worst, I'll sacrifice all of my buddy's hair here."
 As he spoke, his expression became solemn, and he picked up a piece of paper similar to a supermarket receipt and looked at it for a few times:
 "19.10 and 19.36kDa, the positions of the protein electrophoresis bands are consistent with the predicted molecular weights, Xiao Ren, let's go directly to the fluorescence competition binding test.
 Try to measure the binding ability of 3,11-dimethyl-n-heptacosane-2-one and the target pheromone within three hours, which will make it much easier for us. "
 Ren Yongcun adjusted his glasses and skillfully combined the two reagents he had prepared.
 Xu Yun stood in a ventilated ultra-clean bench and added 1 μg of target pheromone, 4 μg of Anchored Oligo, 10 μl of 2×ESReaction Mix, 1 μl of gDNARemover, and finally added RNase-free Water until the volume of the mixture was 20 μl.
 Then he flicked 20 μl of the mixture in the test tube to mix it evenly and handed it to Zhou Peiyao:
 "Xiaozhou, set 42°C, incubate in the PCR instrument for 15 minutes, then heat at 85° for 5 seconds.
 The synthesized cDNA template is then quantified, tested by 1.2% agarose gel electrophoresis, and stored in an environment of minus 20 degrees Celsius. "
 Zhou Peiyao took the test tube and nodded heavily:
 "Don't worry, senior!"
 If yesterday's cyclization experiment was a Cthulhu dog food article, then today's synthesis experiment is undoubtedly a healing story.
 From its slumber, it was awakened.
 The colleagues around him urged it:
 "Hey, it's time to get up. You haven't moved since the last cycle."
 Oh, it came to mind, it is a linear depolymerase and has not yet encountered its sigma factor.
 Although Christmas had just happened a few days ago, it was just an ordinary night for it.
 He walked and walked with his companion. After an unknown amount of time, a gentle call came from its ear.
 "Are you OK?"
 It turned its head and saw a beautiful figure, slim and graceful, with a smile like a flower.
 It didn't know how to answer for a moment, so it could only say dryly:
 "Hello...hello."
 She was so beautiful that she didn't dare to pray for anything. Maybe she just came to ask where the nearest promoter was. The polymerase there was much stronger than its synthetic ability.
 "Um... I'm an Oligo primer. I accidentally got lost. Could you please give me directions?"
 It looked into her eyes and said without thinking:
 "OK."
 It connected her binding domains in a gentlemanly manner, and she shyly acquiesced, and they just walked around in the nuclear matrix, counting the beautiful strips on the chromosomes with her.
 Just like this, I don’t know how many cycles have passed.
 One day, she suddenly shook its beta pliers in surprise:
 "Look there!"
 It looked in the direction of her finger, which was a sequence:
 AUGAUACUCUAGGUGGAGUAUUGAUGA
 that is not.....
 The password of love?
 She ran all the way over and leaned gently on the -35 sequence, with a look of confusion on her face.
 Looking at this scene, it suddenly took courage:
 "Um...can you be my girlfriend?"
 Her expression suddenly froze, and a hint of bitterness appeared on her face:
 "I'm just a primer. I may die tomorrow. Our union is cursed..."
 "Definitely not! We will definitely be happy forever!"
 It hugged her and stretched out the two tightly bound complementary strands.
 She didn't resist much, so they started their love journey.
 Everything went smoothly. It looked at the extending chain of messengers behind it, looked back at the cutest girl in its eyes, and felt the urge to protect her throughout its life.
 I am truly lucky to have such a lovely girl by my side for the rest of my life!
 Just like that, another period of time passed.
 But one day, something unexpected happened.
 The temperature of this world suddenly began to drop, and a large amount of matter began to wither, freeze, and even die.
 It used all its strength to surround her tightly, but with a jolt, the structural domain that combined it with her suddenly loosened!
 It shouted heartbreakingly:
 "Hold on to me, don't let go! I will find a way!"
 Her helpless response came through the tremors, with despair and crying:
 "It's useless, I can't do it!"
 After a circulation, she got further and further away from it.
 "Complete our messenger chain, I will love you forever!"
 Her small figure slowly faded out of its sight and disappeared into the cold nuclear fiber layer.
 It shouted to the sky in despair, angrily scolding the injustice of fate.
 But the road that should be walked still has to be walked, but now it is alone.
 It laboriously opened the bonded double strands and placed each nucleotide in place. Each base represented its deep longing for her.
 But gradually, it also felt tired.
 The surrounding electrons are constantly attacking its core protein, and its subunits are gradually loosening. The most shocking thing is that behind it, a short ubiquitin chain has been extended from unknown time.
 It understands that its life is coming to an end.
 As it lay dying, her smile flashed in its mind.
 It turns out that I have always missed her so much. It turns out that I have always loved her deeply.
 Then it dragged its remaining body and walked slowly, until it finally came to a deep pit.
 At this moment, there are countless polymerases identical to it lying in the deep pit. It is not difficult to see from the double strands that they have all met their own her.
 It moved to a corner with some effort and looked at the sky without focus:
 "Does it mean that the combination of primers is destined to be fruitless?"
 In the haze, her three-dimensional structure appeared in front of him. She seemed to be looking at it with a smile and opening her arms to it...
 Just a thousandth of a second before its consciousness was about to dissipate, two figures, one large and one small, suddenly appeared in his peripheral vision:
 It was a similar figure with a similar figure to him. He had no partner by his side, but his temperament was linked to a chain, and he was holding a delicately carved little girl.
 "That's... that's..."
 His breathing suddenly became rapid.
 In fact, it wasn't just him. Almost instantly, due to tio's guidance effect, every 'it' in the pit noticed the coming figure.
 "Honey, did you see that?!"
 It used up the last bit of strength in its body and laughed like this:
 "It turns out...our love is not cursed..."
 at the same time.
 Looking at the tiny red dot on the RPKM value hot spot, Xu Yun couldn't help but let out a sigh of relief:
 "The fourth generation...has finally broken through."